Answer this question

Do you know the correct answer? Make money answering questions! Join now.
  • AUGGCGAACCACGCGCACACCCUG mRNA insert A in front of 2nd G?
