FIND THE ANSWERS

Please help, Transcribe the dna sequence into mRNA? 5' GTATCCCTTGACTTCAAAGGGCCCATGAAGGT 3' what's the Amino acid sequence?

Answer this question

Do you know the correct answer? Make money answering questions! Join now.
  • Please help, Transcribe the dna sequence into mRNA? 5' GTATCCCTTGACTTCAAAGGGCCCATGAAGGT 3' what's the Amino acid sequence?


Answers