FIND THE ANSWERS

Please help, Transcribe the dna sequence into mRNA? 5' GTATCCCTTGACTTCAAAGGGCCCATGAAGGT 3' what's the Amino acid sequence?

Answer this question

Do you know the correct answer? Make money answering questions! Join now.
  • Please help, Transcribe the dna sequence into mRNA? 5' GTATCCCTTGACTTCAAAGGGCCCATGAAGGT 3' what's the Amino acid sequence?


Answers

... (where the DNA is found) into the ... read in the direction from the 5' end to the 3 ... about DNA and RNA . . . To the amino acid and other ...
Read more
Positive: 21 %
Differences Between RNA and DNA ... DNA into RNA not only changes the information ... assembly of a chain of amino acids. Transfer RNA, ...
Read more
Positive: 18 %

More resources

An amino acid sequence is the order ... The sequences of amino acids in the proteins ... The processes of DNA transcription and RNA translation allow ...
Read more
Positive: 21 %
ANSWERS FOR CONSTRUCTING A PROTEIN LAB DNA TEMPLATE ... Transcription copies DNA into messenger RNA. ... Transfer RNA carries amino acids to the ...
Read more
Positive: 16 %
Please help improve this ... it is sometimes desirable to sequence RNA molecules. While sequencing DNA ... Determining part of a protein's amino-acid ...
Read more
Positive: 2 %
... the enzyme RNA polymerase to transcribe only a single strand of DNA. ... the nucleotide sequences of mRNA into specific amino acid ... 5 Reasons You ...
Read more
Positive: 10 %

Show more results